circad | circRNAs associated with diseases

Has_circ_0008274
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Papillary Thyroid Carcinoma	ICD-10	Thyroid and other endocrine glands (D09.3)
DBLink		PMID	30575918
Experimental Method
Sample Type	Tissue and cell lines	Comparison	Primary PTC tissues and corresponding non-cancerous normal tissues were collected from the surgical specimen
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGGGTGGAGTATGATGCTGA Reverse CACACCAGGTTTCACACCAC	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Zhou, GK, Zhang, GY, Yuan, ZN, Pei, R, Liu, DM (2018). Has_circ_0008274 promotes cell proliferation and invasion involving AMPK/mTOR signaling pathway in papillary thyroid carcinoma. Eur Rev Med Pharmacol Sci, 22, 24:8772-8780.